WormMine: Gene WBGene00053271

• WormBase Gene ID: WBGene00053271
• Gene Name: Cre-enol-1
• Sequence Name: CRE01886
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable magnesium ion binding activity and phosphopyruvate hydratase activity. Predicted to be involved in glycolytic process. Predicted to be part of phosphopyruvate hydratase complex. Is an ortholog of C. elegans enol-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE01886.1	CRE01886.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE01886	CRE01886		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Proteins expressed in activated sperm fraction after C. remanei spermatids were activated in vitro.	N.A	WBPaper00054996:activated_sperm_CRE

1 Expression Patterns

• Primary Identifier: Expr1112607
• Remark: Cre-enol-1, AATTTTATTTCCAGGTTAACCAAATTGGATCCGTCACCGAATCTATTGAGGCTGCCAATC, WBGene00053271
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term