WormMine: Gene WBGene00054233

• WormBase Gene ID: WBGene00054233
• Gene Name: CRE26468
• Sequence Name: CRE26468
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Is an ortholog of C. elegans Y43D4A.6; R02C2.1; and zyg-1. In C. elegans, chk-1 is involved in embryo development and mitotic DNA replication checkpoint signaling.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE26468.1	CRE26468.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE26468	CRE26468		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1102493
• Remark: CRE26204, ACAATATTAGACATAGCCTTTGTCGGAAAGTCACAAATGGCCGTTCTATTCGATGAACGG, WBGene00054206
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term