WormMine: Gene WBGene00054428

• WormBase Gene ID: WBGene00054428
• Gene Name: Cre-tpi-1
• Sequence Name: CRE26365
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable triose-phosphate isomerase activity. Is an ortholog of C. elegans tpi-1. In C. elegans, tpi-1 is involved in cell redox homeostasis and determination of adult lifespan.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE26365.1	CRE26365.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE26365	CRE26365		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Proteins expressed in activated sperm fraction after C. remanei spermatids were activated in vitro.	N.A	WBPaper00054996:activated_sperm_CRE
	Proteins expressed in membranous oraganelle fraction after C. remanei spermatids were activated in vitro.	N.A	WBPaper00054996:membranous_oraganelle_CRE

1 Expression Patterns

• Primary Identifier: Expr1100441
• Remark: Cre-tpi-1, GCTATCGGAACTGGAAAGACCGCTTCTCCGGAACAGGCTCAGGAAGTTCACGAATGGATT, WBGene00054428
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term