WormMine: Gene WBGene00054847

• WormBase Gene ID: WBGene00054847
• Gene Name: Cre-lias-1
• Sequence Name: CRE25164
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable 4 iron, 4 sulfur cluster binding activity and lipoate synthase activity. Predicted to be involved in lipoate biosynthetic process. Is an ortholog of C. elegans lias-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE25164.1	CRE25164.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE25164	CRE25164		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1116060
• Remark: CRE25164, TGTTGGTCAAAGAATGGGTTACACCAGAAAAGTTCGACGAATGGGCCGAGTATTCGAAGA, WBGene00054847
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term