WormMine: Gene WBGene00054910

• WormBase Gene ID: WBGene00054910
• Gene Name: Cre-apb-1
• Sequence Name: CRE25196
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable clathrin binding activity. Predicted to be involved in intracellular protein transport and vesicle-mediated transport. Predicted to be part of membrane coat. Is an ortholog of C. elegans apb-1. In C. elegans, apb-1 is involved in embryo development and receptor-mediated endocytosis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE25196.1	CRE25196.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE25196	CRE25196		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1113396
• Remark: Cre-apb-1, ATTTAACAAAAATTCATTCGGATTGATACCTGTCGAGCAGCTCAACCCATCCCCATTGCT, WBGene00054910
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term