WormMine: Gene WBGene00054961

• WormBase Gene ID: WBGene00054961
• Gene Name: CRE25223
• Sequence Name: CRE25223
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable metallopeptidase activity and zinc ion binding activity. Predicted to be involved in proteolysis. Is an ortholog of C. elegans T16G12.1. In C. elegans, T16G12.1 is involved in embryo development; regulation of egg-laying behavior; and regulation of meiotic cell cycle process involved in oocyte maturation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE25223.1	CRE25223.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE25223	CRE25223		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1101586
• Remark: CRE25223, TCTCATTGGTTCAAAGAAATCTGAATTGGATGTTGGTTTACAAGGATTCGTTGGTTTCGT, WBGene00054961
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term