WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00055119 Gene Name  Cre-emb-9
Sequence Name  ? CRE25323 Organism  Caenorhabditis remanei
Automated Description  Predicted to be an extracellular matrix structural constituent. Predicted to be part of collagen trimer. Is an ortholog of C. elegans emb-9. In C. elegans, emb-9 is involved in several processes, including positive regulation of axon regeneration; positive regulation of protein secretion; and response to serotonin. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE25323.1 CRE25323.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE25323 CRE25323   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-emb-9, CAATTCCGTAAGCCAATGTCTCAAACACTCAAGGCCGGAGGACTCAAAGATCGTGTTTCC, WBGene00055119   Expr1110325 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  enables
  part_of

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  enables
  part_of

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term