WormMine: Gene WBGene00055650

• WormBase Gene ID: WBGene00055650
• Gene Name: Cre-rpc-2
• Sequence Name: CRE04747
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable DNA binding activity; DNA-directed 5'-3' RNA polymerase activity; and ribonucleoside binding activity. Predicted to be involved in DNA-templated transcription. Is an ortholog of C. elegans rpc-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE04747.1	CRE04747.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE04747	CRE04747		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1111859
• Remark: CRE04747, GTGTCGTTCCAGCAAGTCGATGGCCAACATCAAAATTCCATATGCCTGCAAGCTTCTCTT, WBGene00055650
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term