WormMine: Gene WBGene00055685

• WormBase Gene ID: WBGene00055685
• Gene Name: Cre-disl-2
• Sequence Name: CRE04763
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable RNA binding activity and RNA nuclease activity. Is an ortholog of C. elegans disl-2. In C. elegans, disl-2 is involved in regulation of cell fate specification and regulation of development, heterochronic.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE04763.1	CRE04763.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE04763	CRE04763		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1115782
• Remark: CRE04763, GTCAACTTGCTGCCTCACTAGGATACGATGAGAAGTGCAATCGAGGTGCTGAAGAAATTC, WBGene00055685
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term