WormMine: Gene WBGene00055831

• WormBase Gene ID: WBGene00055831
• Gene Name: Cre-hex-3
• Sequence Name: CRE04628
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable hexosaminidase activity. Predicted to be involved in carbohydrate metabolic process. Is an ortholog of C. elegans hex-3. In C. elegans, hex-3 is involved in polysaccharide metabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE04628.1	CRE04628.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE04628	CRE04628		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1110727
• Remark: Cre-hex-3, GAAACTATCCCAGTGGCTCTCCCAACTCTCGCAATCAGTATGGAAACAATACTCGAAGGT, WBGene00055831
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term