WormMine: Gene WBGene00055880

• WormBase Gene ID: WBGene00055880
• Gene Name: Cre-taf-9
• Sequence Name: CRE04662
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable protein heterodimerization activity. Predicted to be involved in DNA-templated transcription initiation. Is an ortholog of C. elegans taf-9. In C. elegans, taf-9 is involved in embryo development; positive regulation of transcription by RNA polymerase II; and regulation of mitotic cell cycle, embryonic.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE04662.1	CRE04662.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE04662	CRE04662		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1117924
• Remark: Cre-taf-9, GGATAATTGAACCACCTTCGGCAGTTTTGCGACCGGAACACGTTCAGAATATGCTCAAGC, WBGene00055880
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term