WormMine: Gene WBGene00055915

• WormBase Gene ID: WBGene00055915
• Gene Name: Cre-dpy-18
• Sequence Name: CRE04682
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable L-ascorbic acid binding activity; iron ion binding activity; and procollagen-proline 4-dioxygenase activity. Predicted to be located in endoplasmic reticulum. Is an ortholog of C. elegans dpy-18. In C. elegans, dpy-18 is involved in several processes, including cuticle development involved in collagen and cuticulin-based cuticle molting cycle; embryo development; and embryonic body morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE04682.1	CRE04682.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE04682	CRE04682		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1115035
• Remark: Cre-dpy-18, GGTATAATCTGTTCAAACAAGGAGATGGAAATCCAGATACTCGACATGCTGCCTGTCCAG, WBGene00055915
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term