WormMine: Gene WBGene00056524

• WormBase Gene ID: WBGene00056524
• Gene Name: Cre-phy-3
• Sequence Name: CRE08657
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable L-ascorbic acid binding activity; iron ion binding activity; and oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen. Is an ortholog of C. elegans phy-3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE08657.1	CRE08657.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE08657	CRE08657		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1109541
• Remark: Cre-phy-3, TGGAACTCTCATTTTTGTGCTGAAAACTGCAGAGAAGGGAGGAGGTGAGGCTGGAGAAAA, WBGene00056524
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term