WormMine: Gene WBGene00057373

• WormBase Gene ID: WBGene00057373
• Gene Name: Cre-mog-5
• Sequence Name: CRE11770
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable ATP binding activity and nucleic acid binding activity. Is an ortholog of C. elegans mog-5. In C. elegans, mog-5 is involved in developmental growth; developmental process involved in reproduction; and embryonic body morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE11770.1	CRE11770.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE11770	CRE11770		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1098320
• Remark: Cre-mog-5, TTTTTCTCAGCCATGGTGTTTCGAGAATTTCATCCAAGTGAGAAGTATGAAGAGAGCTCA, WBGene00057373
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term