WormMine: Gene WBGene00057598

• WormBase Gene ID: WBGene00057598
• Gene Name: CRE04026
• Sequence Name: CRE04026
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable calmodulin-lysine N-methyltransferase activity and protein heterodimerization activity. Predicted to be located in cytoplasm. Predicted to be part of FANCM-MHF complex. Is an ortholog of C. elegans Y48E1C.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE04026.1	CRE04026.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE04026	CRE04026		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1115578
• Remark: CRE04026, TCGGTCGATTTGAACACAGAGATTAATGCTATCCTTGAGCAAAAAATTGGCGGAATTTGG, WBGene00057598
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term