WormMine: Gene WBGene00058894

• WormBase Gene ID: WBGene00058894
• Gene Name: Cre-hmgs-1
• Sequence Name: CRE31059
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable hydroxymethylglutaryl-CoA synthase activity. Predicted to be involved in acetyl-CoA metabolic process and farnesyl diphosphate biosynthetic process, mevalonate pathway. Is an ortholog of C. elegans hmgs-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE31059.1	CRE31059.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE31059	CRE31059		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1116451
• Remark: CRE31059, TAATACTTACTTCCTTGACAACATGGATGAACTTTATCGGAGAACATACACACTTCACGA, WBGene00058894
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term