WormMine: Gene WBGene00058930

• WormBase Gene ID: WBGene00058930
• Gene Name: Cre-dnj-19
• Sequence Name: CRE31039
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable heat shock protein binding activity and unfolded protein binding activity. Predicted to be involved in protein folding. Is an ortholog of C. elegans dnj-19. In C. elegans, dnj-19 is involved in response to topologically incorrect protein.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE31039.1	CRE31039.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE31039	CRE31039		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1107517
• Remark: Cre-dnj-19, GTCGAGGACGTGGAGGAGATGCTTATAATGAAGACTCTGACGAAGAACAACAAGAAGGCC, WBGene00058930
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term