WormMine: Gene WBGene00059306

• WormBase Gene ID: WBGene00059306
• Gene Name: Cre-hars-1.1
• Sequence Name: CRE11039
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable ATP binding activity and histidine-tRNA ligase activity. Predicted to be involved in histidyl-tRNA aminoacylation. Predicted to be located in cytoplasm. Is an ortholog of C. elegans hars-1. In C. elegans, hars-1 is involved in germ cell development; nematode larval development; and translation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE11039.1	CRE11039.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE11039	CRE11039		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1102352
• Remark: Cre-hars-1, GCTGAAGAGAGGCGTATCCCATTAGTTGTGCTTATTGGTGAAAGAGAACTTCAAGAGGGA, WBGene00059306
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term