WormMine: Gene WBGene00059852

• WormBase Gene ID: WBGene00059852
• Gene Name: Cre-mgl-2
• Sequence Name: CRE29626
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable DNA binding activity and G protein-coupled receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway and regulation of DNA-templated transcription. Predicted to be located in membrane. Is an ortholog of C. elegans mgl-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE29626.1	CRE29626.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE29626	CRE29626		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1100251
• Remark: Cre-mgl-2, CTTCTGGCTGATTCAATCGAGAATAGCATGCGAACAGTGTTATCAACTGTTGCTGGGAAA, WBGene00059852
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term