WormMine: Gene WBGene00060239

• WormBase Gene ID: WBGene00060239
• Gene Name: Cre-dyf-11
• Sequence Name: CRE17230
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable microtubule binding activity. Is an ortholog of C. elegans dyf-11. In C. elegans, dyf-11 is involved in several processes, including cilium organization; dauer entry; and hyperosmotic response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE17230.1	CRE17230.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE17230	CRE17230		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1105939
• Remark: Cre-dyf-11, ACGACATTGAGTCCATGATAAAAGAATTGGAACGTTGGAGAAGTGAACAACGACGGAACG, WBGene00060239
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term