WormMine: Gene WBGene00061749

• WormBase Gene ID: WBGene00061749
• Gene Name: Cre-smc-4
• Sequence Name: CRE20351
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable ATP binding activity and ATP hydrolysis activity. Predicted to be involved in chromosome organization. Predicted to be located in chromosome. Is an ortholog of C. elegans smc-4. In C. elegans, smc-4 is involved in mitotic sister chromatid segregation and positive regulation of nematode male tail tip morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE20351.1	CRE20351.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE20351	CRE20351		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1105881
• Remark: Cre-smc-4, TATCGACTTGGAGGAAAAAGCTATCGACGGAGAAGGATTAGAGGGGAAGAAATCGGCTCT, WBGene00061749
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term