WormMine: Gene WBGene00061928

• WormBase Gene ID: WBGene00061928
• Gene Name: CRE14973
• Sequence Name: CRE14973
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable glucosamine-6-phosphate deaminase activity. Predicted to be involved in N-acetylglucosamine metabolic process and carbohydrate metabolic process. Is an ortholog of C. elegans T03F6.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE14973.1	CRE14973.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE14973	CRE14973		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1103647
• Remark: CRE14973, ACCAAGCCATCGAATGCGGAATCTCCCATATGTGTACCGTTTCGGCGATGCAAATGCACA, WBGene00061928
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term