WormMine: Gene WBGene00062350

• WormBase Gene ID: WBGene00062350
• Gene Name: Cre-lin-44
• Sequence Name: CRE24001
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable signaling receptor binding activity. Predicted to be involved in Wnt signaling pathway. Predicted to be located in extracellular region. Is an ortholog of C. elegans lin-44. In C. elegans, lin-44 is involved in several processes, including cell differentiation; nematode male tail tip morphogenesis; and positive regulation of cell projection organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE24001.1	CRE24001.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE24001	CRE24001		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1114632
• Remark: Cre-lin-44, CAAGAGCTAAACTATACACGGATGACTCTGTTGTAAAGACAACTGATTTGATCTACCTGG, WBGene00062350
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term