WormMine: Gene WBGene00062531

• WormBase Gene ID: WBGene00062531
• Gene Name: Cre-rps-5
• Sequence Name: CRE12771
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to be a structural constituent of ribosome. Predicted to be involved in translation. Predicted to be part of small ribosomal subunit. Is an ortholog of C. elegans rps-5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE12771.1	CRE12771.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE12771	CRE12771		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1100945
• Remark: CRE12771, TGACGAGCTTATCAATGCAGCCAAGGGATCCTCCAACAGCTACGCCATCAAGAAGAAGGA, WBGene00062531
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term