WormMine: Gene WBGene00064544

• WormBase Gene ID: WBGene00064544
• Gene Name: Cre-efa-6
• Sequence Name: CRE31340
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable guanyl-nucleotide exchange factor activity and phospholipid binding activity. Predicted to be involved in regulation of ARF protein signal transduction. Is an ortholog of C. elegans efa-6. In C. elegans, efa-6 is involved in several processes, including mitotic nuclear membrane disassembly; regulation of cellular component organization; and regulation of mitotic centrosome separation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE31340.1	CRE31340.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE31340	CRE31340		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1106441
• Remark: Cre-efa-6, GGAAAATGGTGTACGCTCGACTGCGTGGACTCGTTCTCTACTTTGACACCGATGAGCATC, WBGene00064544
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term