WormMine: Gene WBGene00064589

• WormBase Gene ID: WBGene00064589
• Gene Name: Cre-npp-8
• Sequence Name: CRE31396
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to be a structural constituent of nuclear pore. Predicted to be involved in nucleocytoplasmic transport. Predicted to be part of nuclear pore. Is an ortholog of C. elegans npp-8. In C. elegans, npp-8 is involved in embryo development; nucleus organization; and regulation of exit from mitosis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE31396.1	CRE31396.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE31396	CRE31396		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1097337
• Remark: Cre-npp-8, ACAAACTCAAGTTGGCACTCCTTCACTGCGCCGGAATGTATATTGAAGAGCATATATTCG, WBGene00064589
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term