WormMine: Gene WBGene00064774

• WormBase Gene ID: WBGene00064774
• Gene Name: CRE11185
• Sequence Name: CRE11185
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable poly-ADP-D-ribose binding activity and ubiquitin protein ligase activity. Predicted to be involved in Wnt signaling pathway. Is an ortholog of C. elegans C55A6.12.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE11185.1	CRE11185.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE11185	CRE11185		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1099210
• Remark: CRE11185, CGCGCCGAGACCGCCTACGACACCGAGTCCTACACAGCCACCTACAAGAGAGTCTACTGA, WBGene00064774
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term