WormMine: Gene WBGene00064839

• WormBase Gene ID: WBGene00064839
• Gene Name: Cre-fem-2
• Sequence Name: CRE25665
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable protein serine/threonine phosphatase activity. Is an ortholog of C. elegans fem-2. In C. elegans, fem-2 is involved in male sex determination; masculinization of hermaphroditic germ-line; and nematode male tail tip morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE25665.1	CRE25665.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE25665	CRE25665		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1113044
• Remark: Cre-fem-2, AGAAGAAGCGCGTCGAGTCGAAGAAGCCGGCGGACAACTATTCGTGATCGGTGGCGAGTT, WBGene00064839
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term