WormMine: Gene WBGene00064871

• WormBase Gene ID: WBGene00064871
• Gene Name: Cre-daf-7.2
• Sequence Name: CRE25709
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable growth factor activity. Predicted to be located in extracellular region. Is an ortholog of C. elegans daf-7. In C. elegans, daf-7 is involved in several processes, including cellular response to organic substance; regulation of gene expression; and response to bacterium.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE25709.1	CRE25709.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE25709	CRE25709		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1096452
• Remark: Cre-daf-7, CAAGCTCATTTATGTCAATCGTGATGGCAAAGTGACTCTGGCCAACGTCAATGGAATGGT, WBGene00064871
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term