WormMine: Gene WBGene00065463

• WormBase Gene ID: WBGene00065463
• Gene Name: Cre-rtcb-1
• Sequence Name: CRE20444
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to be involved in RNA processing. Is an ortholog of C. elegans rtcb-1. In C. elegans, rtcb-1 is involved in IRE1-mediated unfolded protein response and tRNA exon ligation utilizing 2',3' cyclic phosphate of 5'-exon as source of linkage phosphate.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE20444.1	CRE20444.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE20444	CRE20444		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1107694
• Remark: CRE20444, CCCAGTTGGGTACACTTGGTGCTGGTAATCATTATGCAGAAGTACAAGTTGTCGATGAAA, WBGene00065463
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term