WormMine: Gene WBGene00066426

• WormBase Gene ID: WBGene00066426
• Gene Name: CRE13345
• Sequence Name: CRE13345
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable D-ribulose-phosphate 3-epimerase activity. Predicted to be involved in carbohydrate metabolic process and pentose-phosphate shunt. Is an ortholog of C. elegans F08F8.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE13345.1	CRE13345.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE13345	CRE13345		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1116159
• Remark: CRE13345, ATCTCTGCAAAAGCCGGTGCAAATGCAATCGTCAGTGGCACTGGAATCATCAAGGCTCCC, WBGene00066426
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term