WormMine: Gene WBGene00066458

• WormBase Gene ID: WBGene00066458
• Gene Name: CRE24782
• Sequence Name: CRE24782
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable 4 iron, 4 sulfur cluster binding activity and oxidoreductase activity, acting on NAD(P)H. Predicted to be located in membrane. Is an ortholog of C. elegans T20H4.5. In C. elegans, T20H4.5 is involved in mitochondrial electron transport, NADH to ubiquinone and response to xenobiotic stimulus.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE24782.1	CRE24782.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE24782	CRE24782		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1097733
• Remark: CRE24782, ATTTCGAGTATTCGACTGAAACTCACGAGGAGTTGTTGTACAACAAGGAGAAACTTCTGT, WBGene00066458
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term