WormMine: Gene WBGene00066611

• WormBase Gene ID: WBGene00066611
• Gene Name: Cre-abts-1
• Sequence Name: CRE03796
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable monoatomic anion transmembrane transporter activity and solute:inorganic anion antiporter activity. Predicted to be involved in monoatomic anion transport. Predicted to be located in membrane. Is an ortholog of C. elegans abts-1. In C. elegans, abts-1 is involved in several processes, including cholinergic synaptic transmission; regulation of GABAergic synaptic transmission; and response to serotonin.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE03796.1	CRE03796.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE03796	CRE03796		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1116850
• Remark: Cre-abts-1, CCCATCTCCACATACTTCTACACAAAATCTGGCTGAAAACACTCCACTTCTGAAGGAAGA, WBGene00066611
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term