WormMine: Gene WBGene00066763

• WormBase Gene ID: WBGene00066763
• Gene Name: CRE07764
• Sequence Name: CRE07764
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable ATP binding activity and MAP kinase activity. Is an ortholog of C. elegans mpk-1. In C. elegans, mpk-1 is involved in several processes, including determination of adult lifespan; intracellular signaling cassette; and positive regulation of nitrogen compound metabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE07764.1	CRE07764.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE07764	CRE07764		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1114312
• Remark: CRE07764, AACACCCGTTCACTGTCGAAATGGAATTCGATGAGCTGCCGAAAGAGCAGTTGAAACAGT, WBGene00066763
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term