WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00069599 Gene Name  Cre-snx-6
Sequence Name  ? CRE21290 Organism  Caenorhabditis remanei
Automated Description  Predicted to enable phosphatidylinositol binding activity. Is an ortholog of C. elegans snx-6. In C. elegans, snx-6 is involved in execution phase of apoptosis and phagosome-lysosome fusion involved in apoptotic cell clearance. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE21290.1 CRE21290.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE21290 CRE21290   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-snx-6, ACTATTTGGCACAATTCAAGAAGACTGTCGCAATGCATGAGGTGTTCTTGCAGAGAGTCG, WBGene00069599   Expr1116143 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term