WormMine: Gene WBGene00069628

• WormBase Gene ID: WBGene00069628
• Gene Name: Cre-mrpl-11
• Sequence Name: CRE23097
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to be a structural constituent of ribosome. Predicted to be involved in translation. Predicted to be located in ribosome. Is an ortholog of C. elegans mrpl-11.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE23097.1	CRE23097.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE23097	CRE23097		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1101130
• Remark: CRE23097, GGATGCTCAATTGAAGGAGTTGGCTGATAAGAAGGCGGCGAAAATGCTCAGAACCACTTG, WBGene00069628
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term