WormMine: Gene WBGene00069835

• WormBase Gene ID: WBGene00069835
• Gene Name: CRE28903
• Sequence Name: CRE28903
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable ubiquitin protein ligase activity. Predicted to be involved in ubiquitin-dependent protein catabolic process via the N-end rule pathway. Is an ortholog of C. elegans F10G7.10.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE28903.1	CRE28903.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE28903	CRE28903		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1115496
• Remark: CRE28903, GAAGAAGACAGAAATCTGAAACGTGGAAAACCGCTGTACCTATGCGAGACGCGACTGAGA, WBGene00069835
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term