WormMine: Gene WBGene00070181

• WormBase Gene ID: WBGene00070181
• Gene Name: Cre-zipt-2.2
• Sequence Name: CRE01334
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable metal ion transmembrane transporter activity. Predicted to be involved in metal ion transport and transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans zipt-2.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE01334.1	CRE01334.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE01334	CRE01334		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1102181
• Remark: CRE01334, TGCACAAAGGTGTGGAGGCGTTCTCAGTTGGACTACAGATTTCTATGGCTAACTCAAATA, WBGene00070181
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term