WormMine: Gene WBGene00070396

• WormBase Gene ID: WBGene00070396
• Gene Name: CRE18213
• Sequence Name: CRE18213
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: NagB/RpiA transferase-like; Initiation factor 2 subunit family; Methylthioribose-1-phosphate isomerase; Initiation factor 2B-related; and Initiation factor 2B alpha/beta/delta. Is an ortholog of C. elegans C01G10.9.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE18213.1	CRE18213.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE18213	CRE18213		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1100912
• Remark: CRE18213, ATAAGAATATCGCCACTGGAGCTGCGATTAAAATTGAGGAGAGACCATCTGGAGAGTTGC, WBGene00070396
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term