WormMine: Gene WBGene00070530

• WormBase Gene ID: WBGene00070530
• Gene Name: CRE07018
• Sequence Name: CRE07018
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable RNA cap binding activity. Predicted to be involved in RNA metabolic process and mRNA export from nucleus. Predicted to be part of nuclear cap binding activity complex.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE07018.1	CRE07018.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE07018	CRE07018		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1114629
• Remark: CRE07018, TTTTAGGGAATTTTGGAGCAAAAGTTGGGGACGAAGTGATTGAGGAGCGAAGACGTCGAA, WBGene00070530
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term