WormMine: Gene WBGene00070777

• WormBase Gene ID: WBGene00070777
• Gene Name: CRE29149
• Sequence Name: CRE29149
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable calcium ion binding activity. Is an ortholog of C. elegans mlc-1 and mlc-2. In C. elegans, mlc-1 is involved in several processes, including muscle organ development; nematode larval development; and regulation of muscle contraction.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE29149.1	CRE29149.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE29149	CRE29149		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1102041
• Remark: CRE29149, TGATTACGTCCAGTTCACCCAGATGCTCAAACATGGAGAGAAGAAGGAGGAGAAGCCATA, WBGene00070777
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term