WormMine: Gene WBGene00073347

• WormBase Gene ID: WBGene00073347
• Gene Name: Cre-him-6.2
• Sequence Name: CRE17749
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable 3'-5' DNA helicase activity; ATP binding activity; and nucleic acid binding activity. Predicted to be involved in DNA recombination; DNA repair; and DNA replication. Is an ortholog of C. elegans him-6. In C. elegans, him-6 is involved in several processes, including determination of adult lifespan; meiotic nuclear division; and resolution of DNA recombination intermediates.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE17749.1	CRE17749.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE17749	CRE17749		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1112776
• Remark: Cre-him-6, CGATTTGTCATCCATTACAGTCTTCCGAAATCAATCGAAGGATACTATCAAGAGACTGGT, WBGene00070262
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

9 GO Annotation

0 Homologues

0 Locations

9 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term