WormMine: Gene WBGene00074616

• WormBase Gene ID: WBGene00074616
• Gene Name: Cre-hrg-6.1
• Sequence Name: CRE12555
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable heme transmembrane transporter activity. Predicted to be involved in heme transport. Is an ortholog of C. elegans hrg-6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE12555b.1	CRE12555b.1		[unknown]
Transcript:CRE12555a.1	CRE12555a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE12555a	CRE12555a		[unknown]
CDS:CRE12555b	CRE12555b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1100780
• Remark: CRE12555, ACTGGAGAAATCAATCATTCACCCAGAAGAACCAGATGATCCATCCACATGGAAATTTTA, WBGene00074616
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term