WormMine: Gene WBGene00076982

• WormBase Gene ID: WBGene00076982
• Gene Name: CRE03569
• Sequence Name: CRE03569
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable P-type transmembrane transporter activity. Predicted to be located in membrane. Is an ortholog of C. elegans catp-6. In C. elegans, catp-6 is involved in protein folding.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE03569.1	CRE03569.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE03569	CRE03569		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1100319
• Remark: CRE03569, CATATTACGCATCGCTTATTGTGGTTCTTTCACTTGCATCAATTGTTATGGATGTTTATC, WBGene00076982
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term