WormMine: Gene WBGene00077298

• WormBase Gene ID: WBGene00077298
• Gene Name: Cre-vav-1
• Sequence Name: CRE16749
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable guanyl-nucleotide exchange factor activity. Is an ortholog of C. elegans vav-1. In C. elegans, vav-1 is involved in several processes, including negative regulation of Notch signaling pathway; positive regulation of nematode male tail tip morphogenesis; and regulation of vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE16749.1	CRE16749.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE16749	CRE16749		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1100853
• Remark: Cre-vav-1, GACGGCAAATTTCTTTCGTTCAAAACTGGTGACACCGTAGTATTACTAGACACTGTAGGA, WBGene00077298
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term