WormMine: Gene WBGene00080687

• WormBase Gene ID: WBGene00080687
• Gene Name: CRE22105
• Sequence Name: CRE22105
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to be part of myosin complex. Is an ortholog of C. elegans nmy-2. In C. elegans, nmy-2 is involved in several processes, including asymmetric protein localization involved in cell fate determination; cell division; and regulation of anatomical structure morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE22105.1	CRE22105.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE22105	CRE22105		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1099603
• Remark: Cre-nmy-2, GCTTCTGAACGTCAGAACTCGAGAATCCGTCAACTCCGTGCTCAACTCGAGGACGCCGAG, WBGene00080687
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term