WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00081232 Gene Name  CRE13223
Sequence Name  ? CRE13223 Organism  Caenorhabditis remanei
Automated Description  Predicted to be involved in RNA processing. Predicted to be part of nuclear exosome (RNase complex). Is an ortholog of C. elegans crn-3. In C. elegans, crn-3 is involved in apoptotic DNA fragmentation and apoptotic cell clearance. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE13223.1 CRE13223.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE13223 CRE13223   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE13223, TGATTGAGGCTCAAGACAACATAGCAGAGCGAGTTGCCACTCTTCACGAAGCACTTAAGA, WBGene00081232   Expr1100878 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CRE13239, GACTTTGAGCTCTACAATTCATTTCCAACATTCAACGCGTTCATGAAACGATCTGAGGAG, WBGene00082362   Expr1117893 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  involved_in
  part_of

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  part_of

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term