WormMine: Gene WBGene00086678

• WormBase Gene ID: WBGene00086678
• Gene Name: CBG25264
• Sequence Name: CBG25264
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ubiquitin protein ligase activity. Predicted to be involved in ribosome-associated ubiquitin-dependent protein catabolic process. Predicted to be part of RQC complex. Is an ortholog of C. elegans Y54E10A.11.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG25264.1	CBG25264.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG25264	CBG25264		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063706
• Remark: CBG25264, GCGAAATGTTGACAAAGGCATTGAAGGCGCTGAAGACTGCACGATTTGCATGATGACTGT, WBGene00086678
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term