WormMine: Gene WBGene00086842

• WormBase Gene ID: WBGene00086842
• Gene Name: CBG25428
• Sequence Name: CBG25428
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein dimerization activity. Is an ortholog of C. elegans C10A4.1 and K09A11.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG25428a.1	CBG25428a.1		[unknown]
Transcript:CBG25428b.1	CBG25428b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG25428a	CBG25428a		[unknown]
CDS:CBG25428b	CBG25428b		[unknown]

0 RNAi Result

6 Allele

• WBVar00001449
• WBVar00001444
• WBVar00001454
• WBVar00001429
• WBVar00001439
• WBVar00001434

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053043
• Remark: CBG25428, TGGTTTTTGGATGGAACGAATATGAATGAAAATCCGATCGAATGGTGGGCAAGATCAGCC, WBGene00086842
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term