WormMine: Gene WBGene00087413

• WormBase Gene ID: WBGene00087413
• Gene Name: Cbr-dpy-28
• Sequence Name: CBG25999
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in mitotic chromosome condensation. Predicted to be located in nucleus. Is an ortholog of C. elegans dpy-28. In C. elegans, dpy-28 is involved in meiotic sister chromatid segregation; mitotic sister chromatid segregation; and negative regulation of reciprocal meiotic recombination.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG25999b.1	CBG25999b.1		[unknown]
Transcript:CBG25999a.1	CBG25999a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG25999b	CBG25999b		[unknown]
CDS:CBG25999a	CBG25999a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1054980
• Remark: CBG25999, TGTGTCACTCACAAGTGGCCAGAGAGTACGTCCAAATGATTGAGCACATGCAAAGCGTTT, WBGene00087413
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term